- bioinformatics-list - lists2.utas.edu.au

Fwd: [EMBL-ABR Heads of Nodes] ANDS Medical webinar series: focus on Health and Medical data
by Michael Charleston 20 Apr '17

20 Apr '17

For all our interest! Michael Charleston Associate Professor in Bioinformatics Co-director of Data, Knowledge and Decisions Research Theme Head of UTAS node of EMBL-ABR School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 Begin forwarded message: From: Fiona Louise Kerr <fiona.kerr(a)unimelb.edu.au<mailto:fiona.kerr@unimelb.edu.au>> Subject: [EMBL-ABR Heads of Nodes] ANDS Medical webinar series: focus on Health and Medical data Date: 20 April 2017 at 10:55:21 AM AEST To: "embl-abr-headsofnodes(a)lists.embl-abr.org.au<mailto:embl-abr-headsofnodes@lists.embl-abr.org.au>" <embl-abr-headsofnodes(a)lists.embl-abr.org.au<mailto:embl-abr-headsofnodes@lists.embl-abr.org.au>> From: Helen Gardiner <helen.gardiner(a)unimelb.edu.au<mailto:helen.gardiner@unimelb.edu.au>> Date: Thursday, 20 April 2017 at 10:36 am To: Fiona Kerr <fiona.kerr(a)unimelb.edu.au<mailto:fiona.kerr@unimelb.edu.au>> Subject: ANDS Medical webinar series: focus on Health and Medical data To all Node heads We recommend this series to all students and researchers working with health and medical data. Please advertise through your networks. Convenor, Kate LeMay, Senior Research Data Specialist (health and medical data) at ANDS, was interviewed late in 2016 for the EMBL Australia Bioinformatics Resource. We asked her about bioinformatics in general and the data life-cycle in particular. Her message was clear: using a framework like the data life cycle ensures that Australian bioinformaticians and life scientists will keep up with best practice standards being used and developed internationally. Full interview.<http://www.embl-abr.org.au/kate-lemay-interview/> Kind regards, Helen Helen Gardiner | Communications Manager | Melbourne Bioinformatics & EMBL Australia Bioinformatics Resource | University of Melbourne, Victoria 3010, Australia | t: +61 (3) 8344 2055 | m: +61 (0) 448 920 235 | @MelBioInf | @EMBL_ABR | w: http://www.melbournebioinformatics.org.au<https://www.melbournebioinformatics.org.au/> | www.embl-abr.org.au<https://www.embl-abr.org.au/><http://www.braembl.org.au/> | ______________________________ The Australian National Data Service (ANDS<http://www.ands.org.au/>) invite you to join our series of three short 30 minute lunchtime webinars which aim to support better management and publication of Health and Medical data. ANDS is an NCRIS facility whose core purpose is to make Australia’s research data assets more valuable for researchers, research institutions and the nation. These webinars are free and all ANDS materials are licensed Creative Commons CC-BY to enable easy reuse and re-purposing. Who would benefit from attending? * Researchers * Medical Research Institutes * Universities * Clinician researchers at hospitals * Research students (honours, Masters, PhD) * Medical librarians and data managers who deal with sensitive data Speaker list and full webinar details<http://www.ands.org.au/news-and-events/presentations/2017/webinars-heath-an…> These webinars will be recorded. If you can’t attend please register and we will send you the recording and handout links. Webinar summaries The webinars will address commonly held concerns from within the health and medical research field around data publication: 1. Funders and Publishers: What is being asked of researchers? Tues 9 May, 12:30pm-1pm AEST Register <https://attendee.gotowebinar.com/register/63834727562904322> 2. Storing and Publishing Health and Medical Data: Where can I store my data during and after my research project? Tues 16 May, 12:30pm-1pm AEST Register <https://attendee.gotowebinar.com/register/1287487815189085953> 3. Ethics, Legal issues and data sharing: How can I obtain informed consent for sharing my data? What do I need to consider around storage, access, de-identification and plans for sharing? What laws impact upon the collection, handling and sharing of health and medical research data? Tues 23 May, 12:30pm-1pm AEST Register<https://attendee.gotowebinar.com/register/5100061976688695043> Contact kate.lemay(a)ands.org.au<mailto:kate.lemay@ands.org.au>for more information. Kate LeMay Senior Research Data Specialist | Australian National Data Service T: +61 2 6125 8538 | E: kate.lemay(a)ands.org.au<mailto:kate.lemay@ands.org.au> | W: ands.org.au<http://ands.org.au/> Twitter: @katelemayands ORCiD: orcid.org/0000-0002-2405-7365<http://orcid.org/0000-0002-2405-7365> I work Monday-Thursday 9am-2:30pm Physical address: 9 Liversidge Street, Australian National University, Acton, ACT 2601 Postal address: 101 Liversidge Street, Australian National University, Acton, ACT 2601 Please consider the environment before printing this e-mail. _______________________________________________ EMBL-ABR-HeadsofNodes mailing list EMBL-ABR-HeadsofNodes(a)lists.embl-abr.org.au<mailto:EMBL-ABR-HeadsofNodes@lists.embl-abr.org.au> https://lists.embl-abr.org.au/cgi-bin/mailman/listinfo/embl-abr-headsofnodes University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Re: bioinformatics-list Digest, Vol 19, Issue 3
by vikrant singh 20 Mar '17

20 Mar '17

Dear Dr Jac Charlesworth, I am Interested in to help with a genomics conference. Regards, Vikrant On Mon, Mar 20, 2017 at 2:23 PM, < bioinformatics-list-request(a)list.utas.edu.au> wrote: > Send bioinformatics-list mailing list submissions to > bioinformatics-list(a)list.utas.edu.au > > To subscribe or unsubscribe via the World Wide Web, visit > https://lists.utas.edu.au/mailman/listinfo/bioinformatics-list > or, via email, send a message with subject or body 'help' to > bioinformatics-list-request(a)list.utas.edu.au > > You can reach the person managing the list at > bioinformatics-list-owner(a)list.utas.edu.au > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of bioinformatics-list digest..." > > > Today's Topics: > > 1. Looking for PhD students to help with a genomics conference > in Hobart late Oct (Jac Charlesworth) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Mon, 20 Mar 2017 03:23:56 +0000 > From: Jac Charlesworth <jac.charlesworth(a)utas.edu.au> > Subject: Looking for PhD students to help with a genomics conference > in Hobart late Oct > To: "bioinformatics-list(a)utas.edu.au" > <bioinformatics-list(a)utas.edu.au> > Message-ID: <f0f6a6d950fb4ca189b74a3b46ad53ab(a)MBX12.utas.ad.internal> > Content-Type: text/plain; charset="us-ascii" > > Hi all, > > I'm looking for 2 local PhD students with an interest in genomics to > organise the student function as part of the Australasian Genomic > Technologies Association conference that will be in Hobart Oct 29th to Nov > 1st (http://agtaconference.org/) > > AGTA is an excellent interdisciplinary genomics conference. We have a > great line up of international speakers, with nationals soon to be > announced. > > The student function will have some budget for a venue and evening even > planned by PhD students and ECRs for their peers. We've previously seen > quiz nights, career mentoring sessions and 'science at the pub' type > speaking/socialising events. The students would work with the AGTA17 > organising committee in terms of organising the social event, but we're > hoping they will lead it. > > We'll provide conference registration as a thank you. > > Of you know someone who might be a good pick for this role please let me > know. It's good CV material and shouldn't be too onerous. > > Thanks in advance- > > Jac (convenor AGTA17) > > Dr Jac Charlesworth > Senior Research Fellow - Computational Genomics > Menzies Institute for Medical Research > University of Tasmania > p 6226 4607 | m 0424 709 440 | f 6226 7704 > 17 Liverpool St (Private Bag 23) > Hobart TAS 7001 | www.menzies.utas.edu.au<http://www.menzies.utas.edu.au/> > [cid:image001.png@01D2A185.368A20B0]<http://agtaconference.org/> > > > University of Tasmania Electronic Communications Policy (December, 2014). > This email is confidential, and is for the intended recipient only. > Access, disclosure, copying, distribution, or reliance on any of it by > anyone outside the intended recipient organisation is prohibited and may be > a criminal offence. Please delete if obtained in error and email > confirmation to the sender. The views expressed in this email are not > necessarily the views of the University of Tasmania, unless clearly > intended otherwise. >

1 0

Looking for PhD students to help with a genomics conference in Hobart late Oct
by Jac Charlesworth 20 Mar '17

20 Mar '17

Hi all, I'm looking for 2 local PhD students with an interest in genomics to organise the student function as part of the Australasian Genomic Technologies Association conference that will be in Hobart Oct 29th to Nov 1st (http://agtaconference.org/) AGTA is an excellent interdisciplinary genomics conference. We have a great line up of international speakers, with nationals soon to be announced. The student function will have some budget for a venue and evening even planned by PhD students and ECRs for their peers. We've previously seen quiz nights, career mentoring sessions and 'science at the pub' type speaking/socialising events. The students would work with the AGTA17 organising committee in terms of organising the social event, but we're hoping they will lead it. We'll provide conference registration as a thank you. Of you know someone who might be a good pick for this role please let me know. It's good CV material and shouldn't be too onerous. Thanks in advance- Jac (convenor AGTA17) Dr Jac Charlesworth Senior Research Fellow - Computational Genomics Menzies Institute for Medical Research University of Tasmania p 6226 4607 | m 0424 709 440 | f 6226 7704 17 Liverpool St (Private Bag 23) Hobart TAS 7001 | www.menzies.utas.edu.au<http://www.menzies.utas.edu.au/> [cid:image001.png@01D2A185.368A20B0]<http://agtaconference.org/> University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Opportunity to learn about genome annotation and bio-curation
by Michael Charleston 10 Mar '17

10 Mar '17

Dear all, Bioinformatics users and researchers in Tasmania have a great opportunity to welcome an expert in genome annotation and bio-curation in the form of Dr Monica (Moni) Munoz-Torres from the Lawrence Berkeley National Laboratory in California. Dr Munoz-Torres’ home page: http://www.berkeleybop.org/people/monica-munoz-torres/ Google Scholar page: https://scholar.google.com.au/citations?hl=en&user=GaQVcBAAAAAJ&view_op=lis… and linkedin: https://www.linkedin.com/in/monimunozto/ Dr Munoz-Torres is able to travel to Hobart to deliver two workshops on 10th/11th of July this year (a Monday and Tuesday) on Genome Annotation and Open Science Bio/curation. EMBL-ABR(whose Deputy Director, Vicky Schneider, is cc’d) is coordinating an Australian tour by Dr Munoz-Torres, which will cut costs considerably, but in order for us to afford to bring her here we will to raise some funds! Please can I get a very quick show of hands, of people who would with high probability (at least 80%) pay up to $100 for a two-day workshop? The more we can get, the lower will be the total cost. I estimate we need to raise around $1650 which means at least 16.5 people :) I need to know as soon as possible so we can grab this opportunity – do let me know if you’re seriously interested! Best wishes Mike Michael Charleston Associate Professor in Bioinformatics Co-director of Data, Knowledge and Decisions Research Theme School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

3 2

KMA712 Introduction to Bioinformatics
by Michael Charleston 02 Feb '17

02 Feb '17

Don’t forget to enrol in Introduction to Bioinformatics this semester! * Learn how to use current bioinformatics software! * Learn how to do sequence alignment, phylogenetic analysis, RNA-Seq analysis, and next-generation sequencing analyses like mapping and de novo assembly! * Use the command-line like a boss! * Understand how bioinformatics algorithms work! * Cake! Big Data! Contact me directly if you have questions. Go on, you know you want to. University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Doodle poll weirdness
by Michael Charleston 10 Jan '17

10 Jan '17

Hi all, Looks like if you're using Windows and Chrome then the poll is very unhelpful: no times or days are visible! Barbara Holland kindly discovered this strange behaviour which doesn't affect my Ubuntu + Firefox combination, and is also gone if she uses Firefox on her Windows machine; hence I advise that if it looks really broken, try a different browser. Cheers Mike -- Michael Charleston Associate Professor in Bioinformatics Co-director of Research Theme in Data, Knowledge and Decisions School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Happy New Year!
by Michael Charleston 09 Jan '17

09 Jan '17

Welcome to 2017, a number with numerous numerical niceties: * it's prime ☺ * the binary expansion is 1111110001 which is rather pretty (I guess 11111100000 was too) * it's 7e1 in hexadecimal * CRISPR<http://www.vox.com/science-and-health/2017/1/3/14093794/crispr-gene-editing…> -- ok so that's nothing to do with the number 2017. * More bioinformatics! -- again, nothing to do with the actual value 2017, but don't hold that against me. This year we promise more workshops, more seminars, more activities! What's on, I hear you ask (in my head)? * Fortnightly meetings with guest seminars! (Dob someone in now!) * Workshops on demand (just start demanding them) * DaSH's Research Bazaar<https://2017.resbaz.com/> * GAMe 2017: Galaxy Australasia Meeting, 3rd-9th February in Melbourne 3rd-9th February (link here<https://www.embl-abr.org.au/game2017/>) * Lorne Genome conference, 12-14 February in Lorne, Victoria (probably too late to get to these two but you never know) * If you can't get to these this year maybe put them in your diaries for *next* year. * COMBINE and ABACBS, 13-15 November in Adelaide (link here<http://www.abacbs.org/conference/>) * Australasian Evolution Society Annual Meeting * Phylomania #9 * These last two are to be coordinated; dates to be determined but late November / early December looking likely It's also a good time to work out when are good meeting times. We had alternate Thursdays 4-5pm, but perhaps that isn't a great time. So there's a Doodle Poll to help us decide.. Cheers, Mike -- Michael Charleston Associate Professor in Bioinformatics Co-director of Research Theme in Data, Knowledge and Decisions School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

[Fwd: FW: Reminder Special Seminar 10am this morning Andrew Dobson Princeton Evolutionary Dynamics of an Emerging Pathogen]
by Michael Charleston 09 Dec '16

09 Dec '16

Late notice but definitely of interest to me! Seminar 1pm in Biological Sciences. > ##SELECTION_END## > Special seminar: > > Professor Andrew Dobson > Ecology and Evolutionary Biology, Princeton University > > "The Eye of the Finch: Evolutionary Dynamics of an Emerging Pathogen" > > Date and time: Thursday 8th December, 1-2pm > Venue: Life Sciences Lecture Theatre 1 > > Andy is pre-eminent in the field of the population and community ecology of infectious diseases. > He works in a variety of ecosystems across the globe. Please visit his website. > https://www.princeton.edu/~dobber/ > > Regards, > > Menna > > > ======================================= > Assoc Prof Menna Jones | ARC Future Fellow > School of Biological Sciences > University of Tasmania > Private Bag 55, Hobart, Tasmania 7001, Australia > > Email: Menna.Jones(a)utas.edu.au > Ph: +61 407 815606 | Fax: +61 3 62262745 > Web: http://fcms.its.utas.edu.au/scieng/zoo/pagedetails.asp?lpersonId=1321 > ======================================= > > > > University of Tasmania Electronic Communications Policy (December, 2014). > This email is confidential, and is for the intended recipient only. Access, disclosure, copying, > distribution, or reliance on any of it by anyone outside the intended recipient organisation is > prohibited and may be a criminal offence. Please delete if obtained in error and email > confirmation to the sender. The views expressed in this email are not necessarily the views of the > University of Tasmania, unless clearly intended otherwise. -- Michael Charleston Associate Professor in Bioinformatics Co-director of Research Theme in Data, Knowledge and Decisions School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444

1 0

p.s. DKD Tea information
by Michael Charleston 31 Oct '16

31 Oct '16

In case you didn't already see it, this is the relevant information: Dear researcher, Please come to the first of the Data, Knowledge and Decisions (DKD) Teas, from 2pm to 5pm on the afternoon of 3rd November, in the Function Room on level 4 of the Centenary building, Sandy Bay campus. This will be a fully catered networking and brainstorming event designed to engender research collaborations across both the DKD theme and the themes it supports. Activities are scheduled to go from 2-4pm, and we are catered for 3-5pm. To begin with there will be short talks from different Data, Knowledge and Decisions researchers in Humanities and Health, some brainstorming activities, then an opportunity to network ideas and discuss future research ideas to take forward. We realise you’re mostly likely horribly busy, so we would be very appreciative if you could spend this time for the Theme. Please let us know if you'll be available to come to this first DKD Tea; we'd love to see you. (It's even a good reason to get away from exam marking...) Space is limited to 40, but don't worry if you cannot make this one: there will be other DKD Teas coming soon to a campus near you! RSVP<https://goo.gl/forms/qPuBu7RZXeW3RABS2> for catering purposes' date (by COB 31 Oct 2016). Best wishes, Mike, Anya, Chris and Natalia Co-directors, Data, Knowledge and Decisions -- Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

DKD Tea #1
by Michael Charleston 31 Oct '16

31 Oct '16

Dear all, If you haven't already seen this, please seriously consider joining in on the first of the Data, Knowledge and Decisions Teas: * This Thursday afternoon, Sandy Bay campus (Function room, level four of Centenary building) * Open to all who do research involving data, knowledge and / or decisions * Free * Catered with nice nibbles and wine * Doesn't require you to know any bioinformatics, data science, mathematics, computer science or statistics. * No hard questions will be asked (unless you ask them) * RSVP here<https://goo.gl/forms/qPuBu7RZXeW3RABS2>! * Free Best wishes, Mike -- Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

No meeting today
by Michael Charleston 27 Oct '16

27 Oct '16

Dear all, Just in case you're not quite upt to date with the even- or odd-ness of the week number, we're at a No-Bioinformatics-Meeting week this week. I'm chasing people to present a paper next week, though I will not be present as I have an engagement with one of my other hats on.. Best wishes Mike -- Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

D'oh!
by Michael Charleston 17 Oct '16

17 Oct '16

Dear all, Andrew Phipps has kindly and gently pointed out to me my appalling error, that Thursday is in fact a Public Holiday in Hobart for Show Day. So, no Bioinformatics. AGAIN. Stay tuned for the next exciting announcement! Cheers Mike -- Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

2 1

Thursday Bioinformatics Blub: we need a paper!
by Michael Charleston 17 Oct '16

17 Oct '16

Dear all, For this week's bioinformatics club, I'm willing to go through a paper -- if you have one of interest, please suggest it! If not then I will have to choose something esoteric and scary with loads of maths. Not really. Anyone have anything they'd like me to talk about, or even better, to guide us through? Please let me know ASAP! Cheers Mike -- Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

FW: High profile seminar - Monday 12-1 pm
by Dorothy Steane 29 Sep '16

29 Sep '16

Hi everyone, In case any of you haven't already received this email from Erik, I urge you to go and listen to Jenny Graves on Monday, if you possibly can. She always speaks well and is an inspiration for everyone ... but especially women in science (god knows how she managed such a brilliant career, with kids and everything! She once said that you have to work bloody hard for 10 years per kid ... i.e., if you have four kids you have to work bloody hard for forty years!). She has been doing molecular genetics forever, since the days when we thought a restriction digest was pretty damn cool and PCR hadn't been invented ... and she's still going strong! Cheers, Dot. From: Biological Sciences Sent: Thursday, 29 September 2016 12:10 PM Subject: High profile seminar - Monday 12-1 pm Hi all On Monday, we are privileged to have a seminar by Distinguished Professor Jenny Marshall Graves AO, FAA from Latrobe University. Her talk will be at 12 pm in Lecture Theatre 2. The title is "Sex, genes and human evolution" (see attached abstract). Professor Graves has a multitude of title, Distinguished Professor at Latrobe, Professor Emeritus, ANU; Thinker in Residence, University of Canberra and , Professorial Fellow at the University of Melbourne, Fellow of the Australian Academy of Sciences and for good measure, Order of Australia. She has published seminal Nature and Science papers (with a H-Index of 55). Her >20 papers in Nature and Science include key work on Devils, Platypus, Humans, and to make it even more special, reptiles. See further details below Please spread the word around your network. Erik Brief Bio (from her website: http://www.latrobe.edu.au/she/staff/profile?uname=jgraves) Jenny Graves made seminal contributions to the understanding of mammalian genome organization and evolution, exploiting the genetic diversity of Australia's unique animals as a source of genetic variation to study highly conserved genetic structures and processes. Her studies of the chromosomes and genes of kangaroos and platypus, devils (Tasmanian) and dragons (lizards) has shed light on the organisation, function and evolution of mammalian genomes, and led to influential new theories of the origin and evolution of human sex chromosomes and sex determining genes. She is (in)famous for her prediction that the human Y chromosome is disappearing. She made critical discoveries that the epigenetic silencing of mammalian X chromosomes occurred by transcriptional inhibition, and is mediated by DNA methylation. Jenny has been involved in international comparative gene mapping and sequencing projects since the mid-1980s, promulgating the value of comparative genomics and the special value of including distantly related species. She initiated projects to sequence the genomes of marsupials and the platypus, and was Foundation Director of the ARC Centre of Excellence in Kangaroo Genomics. Jenny received a BSc Hons and MSc from the University of Adelaide for work on the epigenetic silencing of one X chromosome in female marsupials. She then used a Fulbright Travel Grant to do a PhD in molecular biology at the University of California, Berkeley, which she received in 1971 for her work on the control of DNA synthesis in mammalian cells. In 1971, she returned to Australia as a lecturer in Genetics at La Trobe University, becoming a Professor in 1991. In 2001 she moved to the Research School of Biological Sciences, Australian National University as head of the Comparative Genomics Research Unit and Director of the ARC Centre for Excellence in Kangaroo Genomics. She has recently returned to Melbourne as Distinguished Professor at La Trobe University, but also holds honorary positions at ANU, the University of Canberra and the University of Melbourne. Jenny has published more than 420 scientific works, including 4 books. She was elected a Fellow of the Australian Academy of Science in 1999 and served on the Academy Executive, first as Foreign Secretary, then as Secretary for Education. She is 2006 L'Oreal-UNESCO Laureate, and has received many awards for her work, including the MacFarlane Burnet Medal for research in biology, and an AO. [Picture3] University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

In case you didn't get it from the blog - Fwd: [New post] BAM! Bird Acoustic Monitoring
by Michael Charleston 27 Sep '16

27 Sep '16

Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 Begin forwarded message: From: Bioinformatics in Tasmania <comment-reply(a)wordpress.com<mailto:comment-reply@wordpress.com>> Subject: [New post] BAM! Bird Acoustic Monitoring Date: 27 September 2016 at 12:59:05 PM AEST Reply-To: Bioinformatics in Tasmania <comment+zydz-3t1u732j0vc57twr8(a)comment.wordpress.com<mailto:comment+zydz-3t1u732j0vc57twr8@comment.wordpress.com>> Respond to this post by replying above this line New post on Bioinformatics in Tasmania [http://s0.wp.com/i/emails/blavatar.png] [http://0.gravatar.com/avatar/60993ebeabab99e5012bc8ac9c8ebf3c?s=50&d=identi…]<https://bioinformaticstasmania.wordpress.com/author/mcharleston/> BAM! Bird Acoustic Monitoring<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> by Michael Charleston<https://bioinformaticstasmania.wordpress.com/author/mcharleston/> Scott Whitemore<mailto:scott.whitemore@utas.edu.au> has kindly agreed to give us a seminar THIS Thursday (29th September) about his current work on using computational and statistical methods to identify birds from their calls. 4pm, usual place! (Lecture Theatre 2, Maths & Physics building.) Michael Charleston<https://bioinformaticstasmania.wordpress.com/author/mcharleston/> | 2016-09-27 at 12:59 pm | Categories: bioinformatics<https://bioinformaticstasmania.wordpress.com/?cat=60424> | URL: http://wp.me/p6bMKq-c6 Comment<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> See all comments<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> Like<https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m…> Unsubscribe<https://subscribe.wordpress.com/?key=fdc9303f3833fab447d3e952e039a780&email…> to no longer receive posts from Bioinformatics in Tasmania. Change your email settings at Manage Subscriptions<https://subscribe.wordpress.com/?key=fdc9303f3833fab447d3e952e039a780&email…>. Trouble clicking? Copy and paste this URL into your browser: https://bioinformaticstasmania.wordpress.com/2016/09/27/bam-bird-acoustic-m… Thanks for flying with [https://s0.wp.com/i/emails/blavatar-default.png] WordPress.com<https://wordpress.com/> University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

KMA712 / Introduction to Bioinformatics
by Michael Charleston 27 Sep '16

27 Sep '16

Dear all, I’ve had approved after much administrative pain a change of the delivery of KMA712 from the Short Sharp Shock approach (a.k.a. firehose or “I Know Kung Fu” / The Matrix) to a MUCH more digestible pace; as a through-the-semester unit with lectures (available online as well as live) and labs where you get to do stuff. It will run in Semester next year on the Sandy Bay Campus and I’ll record the lectures so it should be functionally accessible remotely. If you’re interested in this unit, please let me know! If you know someone who might be interested, let *them* know. CIRCULATE WIDELY! Where it says "It is intended that the unit will move to a more blended mode, allowing the unit to run through Semester 1 using mainly on-line delivery. This is to be confirmed for 2017.“ on the website at http://www.utas.edu.au/courses/set/units/kma712-bioinformatics, that has been confirmed. Let me know if you want to know more. Best wishes Mike Please check out Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

How to find the perfect match
by Michael Charleston 20 Sep '16

20 Sep '16

Are you troubled by not finding the perfect match? Well, having discussed sequence alignment for the last couple of weeks I thought this would be a good time to talk about how finding a perfect match works. That is, how to find a sequence, like this one TATCACT … inside another (database of) other sequence(s): TTAGCTACTTACTAGCGTCATATCACTTATCTAGCATTCATCTGTACGTATCTAC TTAGCTACTTACTAGCGTCATATCCCTTATCTAGCATTCATCTGTACGTATCTAC TTATCGACTATCATGACTATAGCTATCTGAGGTCAGTCGTTACTATATTATTATCTGCGCGCGATTACGTAGCTACTTACTAGCGTCATATCCCTTATCTAGCATTCATCTGTACGTATCTAC … and of course you know you just use Command-F. But how do we find a matching string that’s 25 bases long, in a list of 100,000,000,000 bases? And then, how do you find all of them? That’s the question that we have to be able to answer, if we want to, say, do BLAST. Given that sequence alignment is essentially a bit slow (it’s O(n^2): takes roughly an amount of time proportional to the square of the sequence lengths), we need to use a fast method to find matching strings, that doesn’t have to use alignment. I’ll talk about these things on Thursday of this week: * finding the perfect match * hashing * BLAST See you then! (I hope…) Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Sequence Alignment
by Michael Charleston 08 Sep '16

08 Sep '16

Today in Bioinformatics we talked about how sequence alignment works for two sequences. It uses dynamic programming to guarantee that subject to the scoring method we use (and which cannot get particularly complex), we can find the alignment or alignments that is (are) of the best possible total score. NEXT WEEK – that is, on the 15th of September, I will carry on and talk about multiple sequence alignment. So this is an additional session. It was generally agreed that this would be a welcome continuation, but you should to course feel free to drop in to learn how multiple sequence alignment is done. There will be plenty of opportunity to ask questions. If you’ve always wondered whether you should align by hand or by using Muscle, T-Coffee, or some method chosen for you that you just go along with, that would be a good time to ask! If you’d like to know about BLAST, this would also be a good time. Cheers for now! Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Today! Bioinformatics!
by Michael Charleston 08 Sep '16

08 Sep '16

Dear all, Today I’d like to begin with adding to the list of topics we’d like to cover in these sessions. So far we have (mainly from me, I might add — hint, hint).. * CRISPR * Sequence alignment * Phylogenetic inference * Finding perfectly matching sequences * Gene finding * Mass Spec analysis * Phylogenetic networks * Scripting and workflows * More command-line-fu * Backing up data * Phylogenetic Trees * Mapping / Aligning sequence to reference genome * Population genetics analysis of SNP and other sequence data So I’ll talk today, once we do spend some time planning ahead, on how sequence alignment works. See you at 4pm! Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

meeting topics
by Michael Charleston 05 Sep '16

05 Sep '16

So, While it’s a bit intimidating to ask “Hey, can you present something?” maybe it’s easier to answer the following question: What topics would you like to learn about in bioinformatics? E.g., * sequence alignment * mapping reads to a reference genome * metabolomics * proteomics * estimating trees * etc. I’ll put something up on the new UTAS blog: http://blogs.utas.edu.au/bioinformatics/2016/09/05/topics-to-discuss-in-our… Add your suggestions in the comments and I’ll see what I can do… Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

A gentle reminder
by Michael Charleston 05 Sep '16

05 Sep '16

Hi all, This is a gentle reminder, and a request on bended knee, about this week’s meeting on Thursday, 4pm, Maths & Physics building, lecture theatre 2. The reminder is that it’s happening! The request is, can anyone step up and present a paper, or talk about their work? Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

A very quick for EMBL-ABR
by Michael Charleston 31 Aug '16

31 Aug '16

Hi folks, If you can spare a minute, and you haven’t already done the survey here: https://www.surveymonkey.com/r/EMBL-ABR16 please can you fill in some answers for the lovely folk at EMBL-ABR? It’s to assess the computing needs of the bioinformatics community at large. We’ve conducted similar things in the not very distant past, but it’s good to keep up to date. Best wishes Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Command-line workshop – a few notes
by Michael Charleston 28 Aug '16

28 Aug '16

Hi folks, If you’re coming along to the command-line workshop / drop-in tomorrow in the Maths & Physics building, I’ve prepared a few thoughts on the original wordpress site (which I think has more followers still), here<https://bioinformaticstasmania.wordpress.com/2016/08/28/command-line-fu/>. Enjoy! Michael Charleston A/Prof in Bioinformatics School of Physical Sciences University of Tasmania phone: +61 3 6226 2444; ext 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

AB^3ACBS 2016 – Conference announcement!
by Michael Charleston 26 Aug '16

26 Aug '16

Check out the conference below! (And the command-line workshop is on THIS MONDAY, the 29th!) University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Command-line workshop on Monday!
by Michael Charleston 26 Aug '16

26 Aug '16

If you’re interested in coming to learn a bit of command-line-fu in a very informal environment, please come along to the Maths & Physics building, room 335 any from from 9am. If you have a computer of your own, do bring it – if you don’t have a University (UTAS) log-in you’ll need your own anyway! If you’re running Windows, and want to do that on the day, you’ll have to have Cygwin<https://www.cygwin.com/> installed. I’ll run through some basics and there will be worksheets to go through; I’ll also attempt to upload some exercises to the blog over the weekend. I’ll try to show you how to copy files around, to find out what’s in files without using a GUI, and we might even have a crack at some scripting, to turn tedious jobs into repeatable workflows.. Don’t worry if you haven’t already let me know you’d like to come: just drop by. Best wishes Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

2025

2024

2023

2022

2021

2020

2019

2018

2017

2016

bioinformatics-list