bioinformatics-list

bioinformatics-list@list.utas.edu.au

1 participants
170 discussions

KMA712 / Introduction to Bioinformatics
by Michael Charleston 27 Sep '16

27 Sep '16

Dear all, I’ve had approved after much administrative pain a change of the delivery of KMA712 from the Short Sharp Shock approach (a.k.a. firehose or “I Know Kung Fu” / The Matrix) to a MUCH more digestible pace; as a through-the-semester unit with lectures (available online as well as live) and labs where you get to do stuff. It will run in Semester next year on the Sandy Bay Campus and I’ll record the lectures so it should be functionally accessible remotely. If you’re interested in this unit, please let me know! If you know someone who might be interested, let *them* know. CIRCULATE WIDELY! Where it says "It is intended that the unit will move to a more blended mode, allowing the unit to run through Semester 1 using mainly on-line delivery. This is to be confirmed for 2017.“ on the website at http://www.utas.edu.au/courses/set/units/kma712-bioinformatics, that has been confirmed. Let me know if you want to know more. Best wishes Mike Please check out Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

How to find the perfect match
by Michael Charleston 20 Sep '16

20 Sep '16

Are you troubled by not finding the perfect match? Well, having discussed sequence alignment for the last couple of weeks I thought this would be a good time to talk about how finding a perfect match works. That is, how to find a sequence, like this one TATCACT … inside another (database of) other sequence(s): TTAGCTACTTACTAGCGTCATATCACTTATCTAGCATTCATCTGTACGTATCTAC TTAGCTACTTACTAGCGTCATATCCCTTATCTAGCATTCATCTGTACGTATCTAC TTATCGACTATCATGACTATAGCTATCTGAGGTCAGTCGTTACTATATTATTATCTGCGCGCGATTACGTAGCTACTTACTAGCGTCATATCCCTTATCTAGCATTCATCTGTACGTATCTAC … and of course you know you just use Command-F. But how do we find a matching string that’s 25 bases long, in a list of 100,000,000,000 bases? And then, how do you find all of them? That’s the question that we have to be able to answer, if we want to, say, do BLAST. Given that sequence alignment is essentially a bit slow (it’s O(n^2): takes roughly an amount of time proportional to the square of the sequence lengths), we need to use a fast method to find matching strings, that doesn’t have to use alignment. I’ll talk about these things on Thursday of this week: * finding the perfect match * hashing * BLAST See you then! (I hope…) Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Sequence Alignment
by Michael Charleston 08 Sep '16

08 Sep '16

Today in Bioinformatics we talked about how sequence alignment works for two sequences. It uses dynamic programming to guarantee that subject to the scoring method we use (and which cannot get particularly complex), we can find the alignment or alignments that is (are) of the best possible total score. NEXT WEEK – that is, on the 15th of September, I will carry on and talk about multiple sequence alignment. So this is an additional session. It was generally agreed that this would be a welcome continuation, but you should to course feel free to drop in to learn how multiple sequence alignment is done. There will be plenty of opportunity to ask questions. If you’ve always wondered whether you should align by hand or by using Muscle, T-Coffee, or some method chosen for you that you just go along with, that would be a good time to ask! If you’d like to know about BLAST, this would also be a good time. Cheers for now! Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Today! Bioinformatics!
by Michael Charleston 08 Sep '16

08 Sep '16

Dear all, Today I’d like to begin with adding to the list of topics we’d like to cover in these sessions. So far we have (mainly from me, I might add — hint, hint).. * CRISPR * Sequence alignment * Phylogenetic inference * Finding perfectly matching sequences * Gene finding * Mass Spec analysis * Phylogenetic networks * Scripting and workflows * More command-line-fu * Backing up data * Phylogenetic Trees * Mapping / Aligning sequence to reference genome * Population genetics analysis of SNP and other sequence data So I’ll talk today, once we do spend some time planning ahead, on how sequence alignment works. See you at 4pm! Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

meeting topics
by Michael Charleston 05 Sep '16

05 Sep '16

So, While it’s a bit intimidating to ask “Hey, can you present something?” maybe it’s easier to answer the following question: What topics would you like to learn about in bioinformatics? E.g., * sequence alignment * mapping reads to a reference genome * metabolomics * proteomics * estimating trees * etc. I’ll put something up on the new UTAS blog: http://blogs.utas.edu.au/bioinformatics/2016/09/05/topics-to-discuss-in-our… Add your suggestions in the comments and I’ll see what I can do… Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

A gentle reminder
by Michael Charleston 05 Sep '16

05 Sep '16

Hi all, This is a gentle reminder, and a request on bended knee, about this week’s meeting on Thursday, 4pm, Maths & Physics building, lecture theatre 2. The reminder is that it’s happening! The request is, can anyone step up and present a paper, or talk about their work? Cheers Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

A very quick for EMBL-ABR
by Michael Charleston 31 Aug '16

31 Aug '16

Hi folks, If you can spare a minute, and you haven’t already done the survey here: https://www.surveymonkey.com/r/EMBL-ABR16 please can you fill in some answers for the lovely folk at EMBL-ABR? It’s to assess the computing needs of the bioinformatics community at large. We’ve conducted similar things in the not very distant past, but it’s good to keep up to date. Best wishes Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Command-line workshop – a few notes
by Michael Charleston 28 Aug '16

28 Aug '16

Hi folks, If you’re coming along to the command-line workshop / drop-in tomorrow in the Maths & Physics building, I’ve prepared a few thoughts on the original wordpress site (which I think has more followers still), here<https://bioinformaticstasmania.wordpress.com/2016/08/28/command-line-fu/>. Enjoy! Michael Charleston A/Prof in Bioinformatics School of Physical Sciences University of Tasmania phone: +61 3 6226 2444; ext 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

AB^3ACBS 2016 – Conference announcement!
by Michael Charleston 26 Aug '16

26 Aug '16

Check out the conference below! (And the command-line workshop is on THIS MONDAY, the 29th!) University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

Command-line workshop on Monday!
by Michael Charleston 26 Aug '16

26 Aug '16

If you’re interested in coming to learn a bit of command-line-fu in a very informal environment, please come along to the Maths & Physics building, room 335 any from from 9am. If you have a computer of your own, do bring it – if you don’t have a University (UTAS) log-in you’ll need your own anyway! If you’re running Windows, and want to do that on the day, you’ll have to have Cygwin<https://www.cygwin.com/> installed. I’ll run through some basics and there will be worksheets to go through; I’ll also attempt to upload some exercises to the blog over the weekend. I’ll try to show you how to copy files around, to find out what’s in files without using a GUI, and we might even have a crack at some scripting, to turn tedious jobs into repeatable workflows.. Don’t worry if you haven’t already let me know you’d like to come: just drop by. Best wishes Mike Michael Charleston Associate Professor in Bioinformatics School of Physical Sciences University of Tasmania AUSTRALIA phone: +61 3 6226 2444 University of Tasmania Electronic Communications Policy (December, 2014). This email is confidential, and is for the intended recipient only. Access, disclosure, copying, distribution, or reliance on any of it by anyone outside the intended recipient organisation is prohibited and may be a criminal offence. Please delete if obtained in error and email confirmation to the sender. The views expressed in this email are not necessarily the views of the University of Tasmania, unless clearly intended otherwise.

1 0

← Newer
1
...
10
11
12
13
14
15
16
17
Older →

Jump to page:

2026

2025

2024

2023

2022

2021

2020

2019

2018

2017

2016

bioinformatics-list